Multigene phylogenetics of euglenids based on single-cell transcriptomics of diverse phagotrophs.

Euglenids are a well-known group of single-celled eukaryotes, with phototrophic, osmotrophic and phagotrophic members. Phagotrophs represent most of the phylogenetic diversity of euglenids, and gave rise to the phototrophs and osmotrophs, but their evolutionary relationships are poorly understood. Symbiontids, in contrast, are anaerobes that are alternatively inferred to be derived euglenids, or a separate euglenozoan group. Most phylogenetic studies of euglenids have examined the SSU rDNA only, which is often highly divergent. Also, many phagotrophic euglenids (and symbiontids) are uncultured, restricting collection of other molecular data. We generated transcriptome data for 28 taxa, mostly using a single-cell approach, and conducted the first multigene phylogenetic analyses of euglenids to include phagotrophs and symbiontids. Euglenids are recovered as monophyletic, with symbiontids forming an independent branch within Euglenozoa. Spirocuta, the clade of flexible euglenids that contains both the phototrophs (Euglenophyceae) and osmotrophs (Aphagea), is robustly resolved, with the ploeotid Olkasia as its sister group, forming the new taxon Olkaspira. Ploeotids are paraphyletic, although Ploeotiidae (represented by Ploeotia spp.), Lentomonas, and Keelungia form a robust clade (new taxon Alistosa). Petalomonadida branches robustly as sister to other euglenids in outgroup-rooted analyses. Within Spirocuta, Euglenophyceae is a robust clade that includes Rapaza, and Anisonemia is a well-supported monophyletic group containing Anisonemidae (Anisonema and Dinema spp.), 'Heteronema II' (represented by H. vittatum), and a clade of Neometanema plus Aphagea. Among 'peranemid' phagotrophs, Chasmostoma branches with included Urceolus, and Peranema with the undescribed 'Jenningsia II', while other relationships are weakly supported and consequently the closest sister group to Euglenophyceae remains unresolved. Our results are inconsistent with recent inferences that Entosiphon is the evolutionarily pivotal sister either to other euglenids, or to Spirocuta. At least three transitions between posterior and anterior flagellar gliding occurred in euglenids, with the phylogenetic positions and directions of those transitions remaining ambiguous.

Phylogenetic and Morphological Evolution of Green Euglenophytes Based on 18S rRNA.

Green euglenophytes are a group of eukaryotes with ancient origin. In order to understand the evolution of the group, it is interesting to know which characteristics are more primitive. Here, a phylogenetic tree of green euglenophytes based on the 18S rRNA gene was constructed, and ancestral states were reconstructed based on eight morphological characters. This research clarifies the phylogenetic relationships of green euglenophytes and provides a basis for the study of the origin of these plants. The phylogenetic tree, which was constructed by Bayesian inference, revealed that: Eutreptia and Eutreptiella were sister groups and that Lepocinclis, Phacus, and Discoplastis were close relatives; Euglena, Cryptoglena, Monomorphina, and Colacium were closely related in addition to Trachelomonas and Strombomonas; and Euglena was not monophyletic. An ancestral reconstruction based on morphological characters revealed seven primitive character states: ductile surface, spirally striated, slightly narrowing or sharp elongated cauda, absence of a lorica, chloroplast lamellar, shield or large discoid, pyrenoid with sheath, and with many small paramylon grains. However, the ancestral state of the length of the flagellum could not be inferred. Euglena and Euglenaria, which both possessed all of the ancestral character states, might represent the most ancient lineages of green euglenophytes.

The Molecular Diversity of Phagotrophic Euglenids Examined Using Single-cell Methods.

Euglenids are a diverse group of euglenozoan flagellates that includes phototrophs, osmotrophs, and phagotrophs. Despite making up most of the phylogenetic diversity of euglenids, phagotrophs remain understudied, and recent work has focused on 'deep-branching' groups. Spirocuta is the large clade encompassing all flexible euglenids including the phototroph and primary osmotroph clades, plus various phagotrophs. Understanding the phylogenetic diversity of phagotrophic spirocutes is crucial for tracing euglenid evolution, including how phototrophs arose. We used single-cell approaches to greatly increase sampling of SSU rDNA for phagotrophic euglenids, particularly spirocutes, including the first sequences from Urceolus, Jenningsia, Chasmostoma, and Sphenomonas, and expanded coverage for Dinema and Heteronema sensu lato, amongst others. Urceolus monophyly is unconfirmed. Organisms referred to Jenningsia form two distinct clades. Heteronema vittatum and similar cells branch separately from Heteronema (c.f.) globuliferum and Teloprocta/Heteronema scaphurum, while Dinema appears as 2-3 clades. Sphenomonas is monophyletic and the deepest branch within Petalomonadida. The census of genera markedly underestimates the phylogenetic diversity of phagotrophs, but taxonomic restraint is necessary when sequences are not available from type species or reasonable surrogates. SSU rDNA phylogenies do not resolve most deep relationships within Spirocuta, but identify units of diversity to sample in future multigene analyses.

Analyses of environmental sequences and two regions of chloroplast genomes revealed the presence of new clades of photosynthetic euglenids in marine environments.

Euglenophyceae are unicellular algae with the majority of their diversity known from small freshwater reservoirs. Only two dozen species have been described to occur in marine habitats, but their abundance and diversity remain unexplored. Phylogenetic studies revealed marine prasinophyte green alga, Pyramimonas parkeae, as the closest extant relative of the euglenophytes' plastid, but similarly to euglenophytes, our knowledge about the diversity of Pyramimonadales is limited. Here we explored Euglenophyceae and Pyramimonadales phylogenetic diversity in marine environmental samples. We yielded 18S rDNA and plastid 16S rDNA sequences deposited in public repositories and reconstructed Euglenophyceae reference trees. We searched high-throughput environmental sequences from the TARA Oceans expedition and Ocean Sampling Day initiative for 18S rDNA and 16S rDNA, placed them in the phylogenetic context and estimated their relative abundances. To avoid polymerase chain reaction (PCR) bias, we also exploited metagenomic data from the TARA Oceans expedition for the presence of rRNA sequences from these groups. Finally, we targeted these protists in coastal samples by specific PCR amplification of two parts of the plastid genome uniquely shared between euglenids and Pyramimonadales. All approaches revealed previously undetected, but relatively low-abundant lineages of marine Euglenophyceae. Surprisingly, some of those lineages are branching within the freshwater or brackish genera.

Ploeotids Represent Much of the Phylogenetic Diversity of Euglenids.

Ploeotids are an assemblage of rigid phagotrophic euglenids that have 10-12 pellicular strips and glide on their posterior flagellum. Molecular phylogenies place them as a poorly resolved, likely paraphyletic assemblage outside the Spirocuta clade of flexible euglenids, which includes the well-known phototrophs and primary osmotrophs. Here, we report SSU rRNA gene sequences from 38 ploeotids, using both single-cell and culture-based methods. Several contain group I or non-canonical introns. Our phylogenetic analyses place ploeotids in 8 distinct clades: Olkasia n. gen., Hemiolia n. gen., Liburna n. gen., Lentomonas, Decastava, Keelungia, Ploeotiidae, and Entosiphon. Ploeotia vitrea, the type of Ploeotia, is closely related to P. oblonga and Serpenomonas costata, but not to Lentomonas. Ploeotia cf. vitrea sensu Lax and Simpson 2013 is not related to P. vitrea and has a different pellicle strip architecture (as imaged by scanning electron microscopy): it instead represents a novel genus and species, Olkasia polycarbonata. We also describe new genera, Hemiolia and Liburna, for the morphospecies Anisonema trepidum and A. glaciale. A recent system proposing 13 suprafamilial taxa that include ploeotids is not supported by our phylogenies. The exact relationships between ploeotid groups remain unresolved and multigene phylogenetics or phylogenomics are needed to address this uncertainty.

Comparative molecular cell biology of phototrophic euglenids and parasitic trypanosomatids sheds light on the ancestor of Euglenozoa.

Parasitic trypanosomatids and phototrophic euglenids are among the most extensively studied euglenozoans. The phototrophic euglenid lineage arose relatively recently through secondary endosymbiosis between a phagotrophic euglenid and a prasinophyte green alga that evolved into the euglenid secondary chloroplast. The parasitic trypanosomatids (i.e. Trypanosoma spp. and Leishmania spp.) and the freshwater phototrophic euglenids (i.e. Euglena gracilis) are the most evolutionary distant lineages in the Euglenozoa phylogenetic tree. The molecular and cell biological traits they share can thus be considered as ancestral traits originating in the common euglenozoan ancestor. These euglenozoan ancestral traits include common mitochondrial presequence motifs, respiratory chain complexes containing various unique subunits, a unique ATP synthase structure, the absence of mitochondria-encoded transfer RNAs (tRNAs), a nucleus with a centrally positioned nucleolus, closed mitosis without dissolution of the nuclear membrane and nucleoli, a nuclear genome containing the unusual 'J' base (ß-D-glucosyl-hydroxymethyluracil), processing of nucleus-encoded precursor messenger RNAs (pre-mRNAs) via spliced-leader RNA (SL-RNA) trans-splicing, post-transcriptional gene silencing by the RNA interference (RNAi) pathway and the absence of transcriptional regulation of nuclear gene expression. Mitochondrial uridine insertion/deletion RNA editing directed by guide RNAs (gRNAs) evolved in the ancestor of the kinetoplastid lineage. The evolutionary origin of other molecular features known to be present only in either kinetoplastids (i.e. polycistronic transcripts, compaction of nuclear genomes) or euglenids (i.e. monocistronic transcripts, huge genomes, many nuclear cis-spliced introns, polyproteins) is unclear.

New phagotrophic euglenids from deep sea and surface waters of the Atlantic Ocean (Keelungia nitschei, Petalomonas acorensis, Ploeotia costaversata).

New phagotrophic euglenoid species from marine surface waters and the deep sea were isolated and described by light and scanning electron microscopy and 18S rDNA sequencing: Keelungia nitschei, Petalomonas acorensis and Ploeotia costaversata. The morphological characteristics of Keelungia nitschei agree with Keelungia pulex besides the slightly truncated anterior front of the cell of our strain. Phylogenetic analysis indicated low sequence similarity between K. nitschei and K. pulex (87.3%). Ploeotia costaversata clustered within the Ploeotia costata clade with a sequence similarity of 96.1% to P. costata strain Tam. Ultrastructural characteristics of our strain revealed helically twisted strips towards both poles of the protoplast. 18S rDNA phylogenies showed that Petalomonas acorensis is related to the clade of Petalomonas cantuscygni/Scytomonas saepesedens with the highest sequence similarity of 81.2% to P. cantuscygni. Six pellicle strips are visible, while two of them reach only the middle of the cell and four (two longitudinal, two helically twisted) join at the posterior front of the cell. Pressure experiments showed that the deep-sea strain K. nitschei was better adapted to high hydrostatic pressures (up to 500 bar) at 4 °C than the two surface water strains. All three strains increased the database (18S rDNA) of the underrepresented group of phagotrophic euglenids.

Intrageneric Variability Between the Chloroplast Genomes of Trachelomonas grandis and Trachelomonas volvocina and Phylogenomic Analysis of Phototrophic Euglenoids.

The latest studies of chloroplast genomes of phototrophic euglenoids yielded different results according to intrageneric variability such as cluster arrangement or diversity of introns. Although the genera Euglena and Monomorphina in those studies show high syntenic arrangements at the intrageneric level, the two investigated Eutreptiella species comprise low synteny. Furthermore Trachelomonas volvocina show low synteny to the chloroplast genomes of the sister genera Monomorphina aenigmatica, M. parapyrum, Cryptoglena skujae, Euglenaria anabaena, Strombomonas acuminata, all of which were highly syntenic. Consequently, this study aims at the analysis of the cpGenome of Trachelomonas grandis and a comparative examination of T. volvocina to investigate whether the cpGenomes are of such resemblance as could be expected for a genus within the Euglenaceae. Although these analyses resulted in almost identical gene content to other Euglenaceae, the chloroplast genome showed significant novelties: In the rRNA operon, we detected group II introns, not yet found in any other cpGenome of Euglenaceae and a substantially heterogeneous cluster arrangement in the genus Trachelomonas. The phylogenomic analysis with 84 genes of 19 phototrophic euglenoids and 18 cpGenome sequences from Chlorophyta and Streptophyta resulted in a well-supported cpGenome phylogeny, which is in accordance to former phylogenetic analyses.

New phagotrophic euglenoid species (new genus Decastava; Scytomonas saepesedens; Entosiphon oblongum), Hsp90 introns, and putative euglenoid Hsp90 pre-mRNA insertional editing.

We describe three new phagotrophic euglenoid species by light microscopy and 18S rDNA and Hsp90 sequencing: Scytomonas saepesedens; Decastava edaphica; Entosiphon oblongum. We studied Scytomonas and Decastava ultrastructure. Scytomonas saepesedens feeds when sessile with actively beating cilium, and has five pellicular strips with flush joints and Calycimonas-like microtubule-supported cytopharynx. Decastava, sister to Keelungia forming new clade Decastavida on 18S rDNA trees, has 10 broad strips with cusp-like joints, not bifurcate ridges like Ploeotia and Serpenomonas (phylogenetically and cytologically distinct genera), and Serpenomonas-like feeding apparatus (8-9 unreinforced microtubule pairs loop from dorsal jaw support to cytostome). Hsp90 and 18S rDNA trees group Scytomonas with Petalomonas and show Entosiphon as the earliest euglenoid branch. Basal euglenoids have rigid longitudinal strips; derived clade Spirocuta has spiral often slideable strips. Decastava Hsp90 genes have introns. Decastava/Entosiphon Hsp90 frameshifts imply insertional RNA editing. Petalomonas is too heterogeneous in pellicle structure for one genus; we retain Scytomonas (sometimes lumped with it) and segregate four former Petalomonas as new genus Biundula with pellicle cross section showing 2-8 smooth undulations and typified by Biundula (=Petalomonas) sphagnophila comb. n. Our taxon-rich site-heterogeneous rDNA trees confirm that Heteronema is excessively heterogeneous; therefore we establish new genus Teloprocta for Heteronema scaphurum.

DNA barcoding in autotrophic euglenids: evaluation of COI and 18s rDNA.

Autotrophic euglenids (Euglenophyceae) are a common and abundant group of microbial eukaryotes in freshwater habitats. They have a limited number of features, which can be observed using light microscopy, thus species identification is often problematic. Establishing a barcode for this group is therefore an important step toward the molecular identification of autotrophic euglenids. Based on the literature, we selected verified species and used a plethora of available methods to validate two molecular markers: COI and 18S rDNA (the whole sequence and three fragments separately) as potential DNA barcodes. Analyses of the COI gene were performed based on the data set of 43 sequences (42 obtained in this study) representing 24 species and the COI gene was discarded as a DNA barcode mainly due to a lack of universal primer sites. For 18S rDNA analyses we used a data set containing 263 sequences belonging to 86 taxonomically verified species. We demonstrated that the whole 18S rDNA is too long to be a useful marker, but from the three shorter analyzed variable regions we recommend variable regions V2V3 and V4 of 18S rDNA as autotrophic euglenid barcodes due to their high efficiency (above 95% and 90%, respectively).

The chloroplast genome of Phacus orbicularis (Euglenophyceae): an initial datum point for the phacaceae.

The Euglenophyceae chloroplast was acquired when a heterotrophic euglenoid engulfed a green alga and subsequently retained the algal chloroplast, in a process known as secondary endosymbiosis. Since this event, Euglenophyceae have diverged widely and their chloroplast genomes (cpGenomes) have as well. Changes to the cpGenome include extensive gene rearrangement and the proliferation of introns, the analyses of which have proven to be useful in examining cpGenome changes throughout the Euglenophyceae. The Euglenales fall into two families, Euglenaceae and Phacaceae. Euglenaceae contains eight genera and at least one cpGenome has been published for each genus. Phacaceae, on the other hand, contains three genera, none of which have had a representative chloroplast genome sequenced. Members of this family have many small disk-shaped chloroplasts that lack pyrenoids. We sequenced and annotated the cpGenome of Phacus orbicularis in order to fill in the large gap in our understanding of Euglenophyceae cpGenome evolution, especially in regard to intron number and gene order. We compared this cpGenome to those of species from both the Euglenaceae and Eutreptiales of the Euglenophyceae phylogenetic tree. The cpGenome showed characteristics that were more derived than that of the basal species Eutreptia viridis, with extensive gene rearrangements and nearly three times as many introns. In contrast, it contained fewer introns than all but one of the previously reported Euglenaceae cpGenomes, had a smaller estimated genome size, and shared greater synteny with two main branches of that family.

Chloroplast Genome Evolution in the Euglenaceae.

Over the last few years multiple studies have been published outlining chloroplast genomes that represent many of the photosynthetic euglenid genera. However, these genomes were scattered throughout the euglenophyceaean phylogenetic tree, and focused on comparisons with Euglena gracilis. Here, we present a study exclusively on taxa within the Euglenaceae. Six new chloroplast genomes were characterized, those of Cryptoglena skujai, E. gracilis var. bacillaris, Euglena viridis, Euglenaria anabaena, Monomorphina parapyrum, and Trachelomonas volvocina, and added to six previously published chloroplast genomes to determine if trends existed within the family. With this study: at least one genome has now been characterized for each genus, the genomes of different strains from two taxa were characterized to explore intraspecific variability, and a second taxon has been characterized for the genus Monomorphina to examine intrageneric variability. Overall results showed a large amount of variability among the genomes, though a few trends could be identified both within Euglenaceae and within Euglenophyta. In addition, the intraspecific analysis indicated that the similarity of a genome sequence between strains was taxon dependent, and the intrageneric analysis indicated that the majority of the evolutionary changes within the Euglenaceae occurred intergenerically.

Phylogenetic Relationships and Morphological Character Evolution of Photosynthetic Euglenids (Excavata) Inferred from Taxon-rich Analyses of Five Genes.

Photosynthetic euglenids acquired chloroplasts by secondary endosymbiosis, which resulted in changes to their mode of nutrition and affected the evolution of their morphological characters. Mapping morphological characters onto a reliable molecular tree could elucidate major trends of those changes. We analyzed nucleotide sequence data from regions of three nuclear-encoded genes (nSSU, nLSU, hsp90), one chloroplast-encoded gene (cpSSU) and one nuclear-encoded chloroplast gene (psbO) to estimate phylogenetic relationships among 59 photosynthetic euglenid species. Our results were consistent with previous works; most genera were monophyletic, except for the polyphyletic genus Euglena, and the paraphyletic genus Phacus. We also analyzed character evolution in photosynthetic euglenids using our phylogenetic tree and eight morphological traits commonly used for generic and species diagnoses, including: characters corresponding to well-defined clades, apomorphies like presence of lorica and mucilaginous stalks, and homoplastic characters like rigid cells and presence of large paramylon grains. This research indicated that pyrenoids were lost twice during the evolution of phototrophic euglenids, and that mucocysts, which only occur in the genus Euglena, evolved independently at least twice. In contrast, the evolution of cell shape and chloroplast morphology was difficult to elucidate, and could not be unambiguously reconstructed in our analyses.

Ultrastructure and molecular phylogenetic position of Neometanema parovale sp. nov. (Neometanema gen. nov.), a Marine phagotrophic euglenid with skidding motility.

Heteronema is a commonly encountered genus of phagotrophic euglenids that contains very different morphotypes, including elongate gliding species and ovoid skidding forms. We report the first ultrastructural and sequence data from a culture of an ovoid skidding heteronemid, KM051. Cells were 8-23.5 µm long with 22 pellicular strips and a fibrous extracellular layer. The tubular extrusomes had dense centre sections. The feeding apparatus was barely visible by light microscopy, but included two microtubule-supported rods. The flagella had hollow, inflated transition zones, heteromorphic paraxonemal rods, and sheaths of flagellar hairs. The posterior flagellum bore a knob that, unusually, sat >2 µm distal to the flagellar base. No ultrastructural features were uniquely shared by KM051 and the elongate, gliding species Heteronema scaphurum. Conversely, the pellicular microtubule array resembles that in deep-branching primary osmotrophs (Aphagea). 18S ribosomal DNA (18S rDNA) phylogenies showed that KM051 is related to a recently obtained Heteronema c.f. exaratum sequence. These skidding heteronemids are not closely related to H. scaphurum, and instead are closely related to Dinema, Anisonema and specifically, Aphagea. The skidding species in Heteronema are transferred to Neometanema gen. nov. (along with most species of Metanema Klebs, 1893), with KM051 described as Neometanema parovale sp. nov.

Morphological and molecular characterisation of Notosolenus urceolatus Larsen and Patterson 1990, a member of an understudied deep-branching euglenid group (petalomonads).

Petalomonads are particularly important for understanding the early evolution of euglenids, but are arguably the least studied major group within this taxon. We have established a culture of the biflagellate petalomonad Notosolenus urceolatus, and conducted electron microscopy observations and molecular phylogenetic analysis. Notosolenus urceolatus has eight pellicular strips bordered by grooves and underlain by close-set microtubules. There are ventral and dorsal Golgi bodies. Mitochondria apparently contain fibrous inclusions, as in Petalomonas cantuscygni. A previously undocumented type of large, globular extrusome is present instead of the tubular extrusomes characteristic of Euglenozoa. The feeding apparatus lacks rods and vanes, and is partly supported by an "MTR". The flagella have complex transition zones that are extremely elongated but unswollen. Only the emergent portion of the anterior flagellum has an organised paraxonemal rod, and also has very fine mastigonemes. The basal bodies are offset and lack connecting fibres. 18S rRNA gene phylogenies show that N. urceolatus is closely related to Petalomonas sphagnophila and P. cantuscygni, not Notosolenus ostium, confirming that current generic assignments based on the number of emergent flagella are phylogenetically unreliable, and making it difficult to infer whether features shared by N. urceolatus and P. cantuscygni (for example) are general for petalomonads.

The evolution of paralogous enzymes MAT and MATX within the Euglenida and beyond.

BACKGROUND: Methionine adenosyltransferase (MAT) is a ubiquitous essential enzyme that, in eukaryotes, occurs in two relatively divergent paralogues: MAT and MATX. MATX has a punctate distribution across the tree of eukaryotes and, except for a few cases, is mutually exclusive with MAT. This phylogenetic pattern could have arisen by either differential loss of old paralogues or the spread of one of these paralogues by horizontal gene transfer. Our aim was to map the distribution of MAT/MATX genes within the Euglenida in order to more comprehensively characterize the evolutionary history of MATX. RESULTS: We generated 26 new sequences from 23 different lineages of euglenids and one prasinophyte alga Pyramimonas parkeae. MATX was present only in photoautotrophic euglenids. The mixotroph Rapaza viridis and the prasinophyte alga Pyramimonas parkeae, which harbors chloroplasts that are most closely related to the chloroplasts in photoautotrophic euglenids, both possessed only the MAT paralogue. We found both the MAT and MATX paralogues in two photoautotrophic species (Phacus orbicularis and Monomorphina pyrum). The significant conflict between eukaryotic phylogenies inferred from MATX and SSU rDNA data represents strong evidence that MATX paralogues have undergone horizontal gene transfer across the tree of eukaryotes. CONCLUSIONS: Our results suggest that MATX entered the euglenid lineage in a single horizontal gene transfer event that took place after the secondary endosymbiotic origin of the euglenid chloroplast. The origin of the MATX paralogue is unclear, and it cannot be excluded that it arose by a gene duplication event before the most recent common ancestor of eukaryotes.

The genus Cyclidiopsis: an obituary.

Since its creation in 1917 the genus Cyclidiopsis, and its validity, has been a source of debate among euglenid taxonomists. While many authors have supported its legitimacy, various other authors have considered it to be a subgenus of Astasia or even promoted its complete dissolution. In this study, we have sequenced the small subunit and large subunit ribosomal DNA of Cyclidiopsis acus, the type species for the genus. Subsequent phylogenetic analyses showed that C. acus grouped with taxa from the genus Lepocinclis, which necessitated the removal of this taxon from Cyclidiopsis and into Lepocinclis as Lepocinclis cyclidiopsis nom. nov. After an extensive literature search it was determined that only two other previously described Cyclidiopsis taxa were morphologically distinct, and the rest were reassigned as synonyms of L. cyclidiopsis. These findings prompted a re-examination of the initial description of Cyclidiopsis, and it was determined that the morphological characters establishing the genus as a distinct group were no longer valid in light of current phylogenetic analyses and the emended generic description for Lepocinclis. Therefore, the remaining two taxa were formally moved to the genus Lepocinclis as L. crescentia comb. nov. and L. pseudomermis comb. nov.

Combining molecular data with classical morphology for uncultured phagotrophic euglenids (Excavata): a single-cell approach.

Phagotrophic euglenids are one of the most diverse and important forms of heterotrophic flagellates in sediment systems, and are key to understanding the evolution of photosynthetic euglenids and 'primary osmotrophs', yet relatively little is known about their biodiversity and phylogenetic relationships. A wealth of light microscopy-based information is available, but little progress has been made in associating this with molecular sequence data. We established a protocol to obtain light microscopy data and molecular data from single euglenid cells isolated from environmental samples. Individual cells from freshwater and marine benthic samples were isolated and rinsed by micropipetting, documented using high-resolution photomicroscopy, then subjected to single-cell nested PCR using taxon-specific primers in combination with universal eukaryotic primers, generating > 75% or full-length SSU rDNA sequences. As a proof-of-principle eight individuals were characterised and subjected to phylogenetic analyses. Many of these cells were identified as Anisonema or Dinema, and grouped with existing sequences assigned to these taxa, and with a 'Peranema sp.' sequence that we could now clearly demonstrate was misidentified or misannotated. Another cell is Heteronema c.f. exaratum, the first 'skidding heteronemid' for which sequence data are available. This is not closely related to Heteronema scaphurum, and intriguingly, branches as the sister group to primary osmotrophs. A cell similar to Ploeotia vitrea (the type of this genus), shows no particular phylogenetic affinity to Ploeotia costata, the best studied Ploeotia species. Our experimental protocol provides a useful starting point for future analyses on euglenid biodiversity (including environmental sequence surveys), and their evolution and systematics.

Transcriptomic study reveals widespread spliced leader trans-splicing, short 5'-UTRs and potential complex carbon fixation mechanisms in the euglenoid Alga Eutreptiella sp.

Eutreptiella are an evolutionarily unique and ecologically important genus of microalgae, but they are poorly understood with regard to their genomic make-up and expression profiles. Through the analysis of the full-length cDNAs from a Eutreptiella species, we found a conserved 28-nt spliced leader sequence (Eut-SL, ACACUUUCUGAGUGUCUAUUUUUUUUCG) was trans-spliced to the mRNAs of Eutreptiella sp. Using a primer derived from Eut-SL, we constructed four cDNA libraries under contrasting physiological conditions for 454 pyrosequencing. Clustering analysis of the ∼1.9×10(6) original reads (average length 382 bp) yielded 36,643 unique transcripts. Although only 28% of the transcripts matched documented genes, this fraction represents a functionally very diverse gene set, suggesting that SL trans-splicing is likely ubiquitous in this alga's transcriptome. The mRNAs of Eutreptiella sp. seemed to have short 5'- untranslated regions, estimated to be 21 nucleotides on average. Among the diverse biochemical pathways represented in the transcriptome we obtained, carbonic anhydrase and genes known to function in the C4 pathway and heterotrophic carbon fixation were found, posing a question whether Eutreptiella sp. employs multifaceted strategies to acquire and fix carbon efficiently. This first large-scale transcriptomic dataset for a euglenoid uncovers many potential novel genes and overall offers a valuable genetic resource for research on euglenoid algae.

Ultrastructure and molecular phylogenetic position of Heteronema scaphurum: a eukaryovorous euglenid with a cytoproct.

Euglenids comprise a distinct clade of flagellates with diverse modes of nutrition, including phagotrophy, osmotrophy and phototrophy. Much of the previous research on euglenids has focused on phototrophic species because of their ecological abundance and significance as indicators for the health of aquatic ecosystems. Although largely understudied, phagotrophic species probably represent the majority of euglenid diversity. Phagotrophic euglenids tend to be either bacterivorous or eukaryovorous and use an elaborate feeding apparatus for capturing prey cells. We characterized the ultrastructure and molecular phylogenetic position of Heteronema scaphurum, a eukaryovorous euglenid collected in freshwater. This species was equipped with a distinct cytoproct through which waste products were eliminated in the form of faecal pellets; a cytoproct has not been reported in any other member of the Euglenida. Heteronema scaphurum also had a novel predatory mode of feeding. The euglenid ensnared and corralled several green algal prey cells (i.e. Chlamydomonas) with hook-like flagella covered in mucous before engulfing the bundle of prey cells whole. Molecular phylogenetic analyses inferred from small subunit rDNA sequences placed this species with other eukaryovorous euglenids, which was consistent with ultrastructural features associated with the feeding apparatus, flagellar apparatus, extrusomes, and pellicle.